Below is the syntax highlighted version of Genome.java.
/****************************************************************************** * Compilation: javac Genome.java * Execution: java Genome - < input.txt (compress) * Execution: java Genome + < input.txt (expand) * Dependencies: BinaryIn.java BinaryOut.java * Data files: https://algs4.cs.princeton.edu/55compression/genomeTiny.txt * * Compress or expand a genomic sequence using a 2-bit code. * * % more genomeTiny.txt * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * * % java Genome - < genomeTiny.txt | java Genome + * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * ******************************************************************************/ package edu.princeton.cs.algs4; /** * The {@code Genome} class provides static methods for compressing * and expanding a genomic sequence using a 2-bit code. * <p> * For additional documentation, * see <a href="https://algs4.cs.princeton.edu/55compression">Section 5.5</a> of * <i>Algorithms, 4th Edition</i> by Robert Sedgewick and Kevin Wayne. * * @author Robert Sedgewick * @author Kevin Wayne */ public class Genome { // Do not instantiate. private Genome() { } /** * Reads a sequence of 8-bit extended ASCII characters over the alphabet * { A, C, T, G } from standard input; compresses them using two bits per * character; and writes the results to standard output. */ public static void compress() { Alphabet DNA = Alphabet.DNA; String s = BinaryStdIn.readString(); int n = s.length(); BinaryStdOut.write(n); // Write two-bit code for char. for (int i = 0; i < n; i++) { int d = DNA.toIndex(s.charAt(i)); BinaryStdOut.write(d, 2); } BinaryStdOut.close(); } /** * Reads a binary sequence from standard input; converts each two bits * to an 8-bit extended ASCII character over the alphabet { A, C, T, G }; * and writes the results to standard output. */ public static void expand() { Alphabet DNA = Alphabet.DNA; int n = BinaryStdIn.readInt(); // Read two bits; write char. for (int i = 0; i < n; i++) { char c = BinaryStdIn.readChar(2); BinaryStdOut.write(DNA.toChar(c), 8); } BinaryStdOut.close(); } /** * Sample client that calls {@code compress()} if the command-line * argument is "-" an {@code expand()} if it is "+". * * @param args the command-line arguments */ public static void main(String[] args) { if (args[0].equals("-")) compress(); else if (args[0].equals("+")) expand(); else throw new IllegalArgumentException("Illegal command line argument"); } } /****************************************************************************** * Copyright 2002-2022, Robert Sedgewick and Kevin Wayne. * * This file is part of algs4.jar, which accompanies the textbook * * Algorithms, 4th edition by Robert Sedgewick and Kevin Wayne, * Addison-Wesley Professional, 2011, ISBN 0-321-57351-X. * http://algs4.cs.princeton.edu * * * algs4.jar is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * algs4.jar is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with algs4.jar. If not, see http://www.gnu.org/licenses. ******************************************************************************/