Below is the syntax highlighted version of Genome.java
from §5.5 Data Compression.
/************************************************************************* * Compilation: javac Genome.java * Execution: java Genome - < input.txt (compress) * Execution: java Genome + < input.txt (expand) * Dependencies: BinaryIn.java BinaryOut.java * * Compress or expand a genomic sequence using a 2-bit code. * * % more genomeTiny.txt * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * * % java Genome - < genomeTiny.txt | java Genome + * ATAGATGCATAGCGCATAGCTAGATGTGCTAGC * *************************************************************************/ public class Genome { public static void compress() { Alphabet DNA = new Alphabet("ACTG"); String s = BinaryStdIn.readString(); int N = s.length(); BinaryStdOut.write(N); // Write two-bit code for char. for (int i = 0; i < N; i++) { int d = DNA.toIndex(s.charAt(i)); BinaryStdOut.write(d, 2); } BinaryStdOut.close(); } public static void expand() { Alphabet DNA = new Alphabet("ACTG"); int N = BinaryStdIn.readInt(); // Read two bits; write char. for (int i = 0; i < N; i++) { char c = BinaryStdIn.readChar(2); BinaryStdOut.write(DNA.toChar(c)); } BinaryStdOut.close(); } public static void main(String[] args) { if (args[0].equals("-")) compress(); else if (args[0].equals("+")) expand(); else throw new RuntimeException("Illegal command line argument"); } }